hypO [2019-06-25 09:51:33]

NAD(P)H-flavin nitroreductase

Locus: BSU07830

Isoelectric point: 5.67

Molecular weight: 25.48 kDa

Protein length: 221 aa

Gene length: 666 bp

Function: protection against NaOCl stress

Product: NAD(P)H-flavin nitroreductase

Essential: no

Synonyms: yfkO

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Electron transport and ATP synthesis → Electron transport/ other/ based on similarity
• Lifestyles → Coping with stress → Resistance against oxidative and electrophile stress

Gene

Coordinates: 854,412 855,077

Phenotypes of a mutant

• a hypO ohrA mutant is more sensitive to NaOCl stress than ohrA single mutant PubMed

The protein

Protein family

• nitroreductase family (according to Swiss-Prot)

Cofactors

• FMN PubMed (according to UniProt)

Structure

• 2H0U (from Helicobacter pylori, 45% identity)

Expression and Regulation

Operons

• Genes: hypO
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • HypR: activation, PubMed, in HypR regulon

  Regulation

  • induced under disulfide stress conditions (diamide, NaOCl) (HypR) PubMed

Biological materials

Mutant

• MGNA-C366 (yfkO::erm), available at the NBRP B. subtilis, Japan
• BKE07830 (hypO::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTAAAACACCTCTCCTT, downstream forward: _UP4_TAAAAGAAGAAAGCTGCTCG
• BKK07830 (hypO::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTAAAACACCTCTCCTT, downstream forward: _UP4_TAAAAGAAGAAAGCTGCTCG

Labs working on this gene/protein

• Haike Antelmann, University of Greifswald, Germany

References

Original publications

Loading